View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5814-22 (Length: 141)
Name: Solexa-NF5814-22
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5814-22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 1e-51; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 7415189 - 7415299
Alignment:
| Q |
1 |
cataggttttggagtgataataaggtcatagattcaacttcccacacttcgacgagtatgggttatcaaacttcaagtttgtagtctagagagatgcgtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7415189 |
cataggttttggagtgataataaggtcataggttcaacttcccacacttcgacgagtatgggttatcaaacttcaagtttgtagtatagagagatgcgtc |
7415288 |
T |
 |
| Q |
101 |
aaaatcgttat |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
7415289 |
aaaatcgttat |
7415299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 7461272 - 7461382
Alignment:
| Q |
1 |
cataggttttggagtgataataaggtcatagattcaacttcccacacttcgacgagtatgggttatcaaacttcaagtttgtagtctagagagatgcgtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7461272 |
cataggttttggagtgataataaggtcataggttcaacttcccacacttcgacgagtatgggttatcaaacttcaagtttgtagtatagagagatgcgtc |
7461371 |
T |
 |
| Q |
101 |
aaaatcgttat |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
7461372 |
aaaatcgttat |
7461382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 141
Target Start/End: Original strand, 7415314 - 7415344
Alignment:
| Q |
111 |
tatagattgaattgataatactttacatttg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7415314 |
tatagattgaattgataatactttacatttg |
7415344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 141
Target Start/End: Original strand, 7461397 - 7461427
Alignment:
| Q |
111 |
tatagattgaattgataatactttacatttg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7461397 |
tatagattgaattgataatactttacatttg |
7461427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University