View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5814-33 (Length: 130)
Name: Solexa-NF5814-33
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5814-33 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 5e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 5e-52
Query Start/End: Original strand, 7 - 130
Target Start/End: Complemental strand, 55208427 - 55208301
Alignment:
| Q |
7 |
aaacaraacaaagcgtttctcaacccacatatattataacgtacaataataataataa---aaggagtttaattagtttgagggtttaacggcgggtcat |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55208427 |
aaacaaaacaaagcgtttctcaacccacatatattataacgtacaataataataataataaaaggagtttaattagtttgagggtctaacggcgggtcat |
55208328 |
T |
|
| Q |
104 |
gagcaagaatcagagagttttggttgt |
130 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
55208327 |
gagcaagaatcagagagttttgtttgt |
55208301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University