View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5814-42 (Length: 124)
Name: Solexa-NF5814-42
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5814-42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 35; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 32876146 - 32876098
Alignment:
| Q |
8 |
ggatgtcttcatccaaatttgaatacatgaaaatcctacgtscgcacga |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| || ||||||| |
|
|
| T |
32876146 |
ggatgtcttcatccaaatttgaatacatgacaatcctgtgtgcgcacga |
32876098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 52 - 93
Target Start/End: Original strand, 39675498 - 39675539
Alignment:
| Q |
52 |
cacgaattaattacgatgtaactatgaaacttcctcactctc |
93 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39675498 |
cacgagttaattacgatctaactatgaaacttcctcactctc |
39675539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University