View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5814-42 (Length: 124)

Name: Solexa-NF5814-42
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5814-42
Solexa-NF5814-42
[»] chr1 (1 HSPs)
chr1 (8-56)||(32876098-32876146)
[»] chr5 (1 HSPs)
chr5 (52-93)||(39675498-39675539)


Alignment Details
Target: chr1 (Bit Score: 35; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 32876146 - 32876098
Alignment:
8 ggatgtcttcatccaaatttgaatacatgaaaatcctacgtscgcacga 56  Q
    |||||||||||||||||||||||||||||| ||||||  || |||||||    
32876146 ggatgtcttcatccaaatttgaatacatgacaatcctgtgtgcgcacga 32876098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 52 - 93
Target Start/End: Original strand, 39675498 - 39675539
Alignment:
52 cacgaattaattacgatgtaactatgaaacttcctcactctc 93  Q
    ||||| ||||||||||| ||||||||||||||||||||||||    
39675498 cacgagttaattacgatctaactatgaaacttcctcactctc 39675539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University