View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5814-43 (Length: 124)
Name: Solexa-NF5814-43
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5814-43 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 10707070 - 10707193
Alignment:
| Q |
1 |
gaacgaagatttttcacacagcaaatcagacagataatgggatatttctctggcttccaacgtttggttttaaatcccatgatagcacatgctactcctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10707070 |
gaacgaagatttttcacacagcaaatcagacagataatgggatatttctctggcttccaacgtttggttttaaatcccatgatagcacatgctgctcctc |
10707169 |
T |
|
| Q |
101 |
ctcaggaaggataaatggcaaaga |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10707170 |
ctcaggaaggataaatggcaaaga |
10707193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 26651869 - 26651746
Alignment:
| Q |
1 |
gaacgaagatttttcacacagcaaatcagacagataatgggatatttctctggcttccaacgtttggttttaaatcccatgatagcacatgctactcctc |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26651869 |
gaacaaagatttttcacacagcaaatcagacagataatgggatatttctctggcttccaacgtttggttttaaatcccatgatagcacatgctgctcctc |
26651770 |
T |
|
| Q |
101 |
ctcaggaaggataaatggcaaaga |
124 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26651769 |
gtcaggaaggataaatggcaaaga |
26651746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University