View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5814-44 (Length: 123)
Name: Solexa-NF5814-44
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5814-44 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 8 - 123
Target Start/End: Original strand, 34676811 - 34676928
Alignment:
| Q |
8 |
cttataagttagatttacatctcta--attttttggtactgtaataacatttttagtttattaacagtggatatctgagctgagacattatgctccaaat |
105 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34676811 |
cttataagttagatttagatctctattattttttggtactgtaataacatttttagtttattaacagtggatatctgagctgagacattatgctccaaat |
34676910 |
T |
|
| Q |
106 |
gtgcctattgtgctggtg |
123 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34676911 |
gtgcctattgtgctggtg |
34676928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University