View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5814-47 (Length: 109)
Name: Solexa-NF5814-47
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5814-47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 3e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 32154079 - 32153972
Alignment:
| Q |
1 |
atgtggtttcgtgcttctagttttctttagttggtggtgatataaacatggagcacgggttaaatgctcaattatcaagtctattgagttttcattgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32154079 |
atgtggtttcgtgcttctagttttctttagttggtggtgatataaacatggagcacaagtaaaatgctcaattatcaagtctattgagttttcattgatt |
32153980 |
T |
 |
| Q |
101 |
caattaac |
108 |
Q |
| |
|
||| |||| |
|
|
| T |
32153979 |
caactaac |
32153972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University