View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5814-49 (Length: 100)
Name: Solexa-NF5814-49
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5814-49 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 1e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 34 - 100
Target Start/End: Complemental strand, 4114301 - 4114235
Alignment:
| Q |
34 |
ttccaaattgccgatgcatatgacacgcagtgattggtgaatcaaatgcatgccaacaacactagag |
100 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4114301 |
ttccaaattgccaaggcatatgacacgcagtgattggtgaatcaaatgcatgccaacaacactagag |
4114235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 35
Target Start/End: Complemental strand, 4114390 - 4114363
Alignment:
| Q |
8 |
atggtaacacaagtatggaaggaaaatt |
35 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
4114390 |
atggtaacacaagtatggaaggaaaatt |
4114363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University