View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5814-5 (Length: 185)
Name: Solexa-NF5814-5
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5814-5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 8 - 150
Target Start/End: Original strand, 54033345 - 54033487
Alignment:
| Q |
8 |
taaacaagagctaccacaatcacaaatgcaggatgatgacataagtaatagggtagatttggaagaaccgcttcttacagataagtcggaatatgtagca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54033345 |
taaacaagagctaccacaatcacaaatgcaggatgatgacataagtaatagggtagatttggaagaaccgcttcttacagataagtcggaatatgtagca |
54033444 |
T |
 |
| Q |
108 |
gagagcaagatggagccctgatgactaaaatactgatagtttg |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54033445 |
gagagcaagatggagccctgatgactaaaatactgatagtttg |
54033487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University