View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5814-52 (Length: 76)
Name: Solexa-NF5814-52
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5814-52 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 7e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 7e-30
Query Start/End: Original strand, 7 - 76
Target Start/End: Complemental strand, 8475570 - 8475501
Alignment:
| Q |
7 |
accattaatgttgaactttgtacatttataaaaagtgactagtcaagctgattatgggcttatcgcggga |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8475570 |
accattaatgttgaactttgtacatttataaaaagtaactagtcaagctgattatgggcttatcgcggga |
8475501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University