View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5814-6 (Length: 202)
Name: Solexa-NF5814-6
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5814-6 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 8 - 191
Target Start/End: Complemental strand, 31045232 - 31045049
Alignment:
| Q |
8 |
aatttacatatactaaaagtttttaatgtgaagatgaagacttgttatctgccgcaagcttcgtttggtgaggctttaggagaagagcaacttttccttt |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31045232 |
aatttacatatacaaaaagtttttaatgtgaagatgaagacttgttatatgccgcaagcttcgtttggtgaggctttaggagaatagcaacttttccttt |
31045133 |
T |
|
| Q |
108 |
acatacactgctgcataccttgcatgtgatgattcatctcactcgacatatggtctttatctgagctctttgcttatagttcat |
191 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||| ||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31045132 |
acatacactgctgaataccttgcatgagatgattcatgtcagactgtttatggtctttatctgagctctttgcttatagttcat |
31045049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 8 - 106
Target Start/End: Original strand, 172140 - 172245
Alignment:
| Q |
8 |
aatttacatatactaaaagtttttaatgtgaagatgaagacttgttatctgcc------gcaagcttcgtttggtgaggctttaggagaagagcaac-tt |
100 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||| |||||| | | |||||||||||||||| ||||||| |||||||||||| || |
|
|
| T |
172140 |
aatttacatatacaaaatgtttttaatgtgaagatgaagacctgttatatatcttctaatcaagcttcgtttggtgtggctttaagagaagagcaacatt |
172239 |
T |
|
| Q |
101 |
ttcctt |
106 |
Q |
| |
|
|||||| |
|
|
| T |
172240 |
ttcctt |
172245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University