View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5814-8 (Length: 180)
Name: Solexa-NF5814-8
Description: NF5814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5814-8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 60 - 125
Target Start/End: Complemental strand, 10393318 - 10393253
Alignment:
| Q |
60 |
gttggcatcgtagtttcttccttatacgttttctccgctatacactattcttctacaacctcttca |
125 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10393318 |
gttgtcatcgttgtttcttccttatacgttttctccgctatacactattcttctacaacctcttca |
10393253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 60 - 125
Target Start/End: Complemental strand, 30844192 - 30844125
Alignment:
| Q |
60 |
gttggcatcgtagtttcttccttatacgttttctccgc--tatacactattcttctacaacctcttca |
125 |
Q |
| |
|
|||| ||| ||||| |||||||||||||| ||||| || |||||||||||||||||||||||||||| |
|
|
| T |
30844192 |
gttgtcatagtagtatcttccttatacgtcttctctgccttatacactattcttctacaacctcttca |
30844125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University