View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5815-1 (Length: 202)
Name: Solexa-NF5815-1
Description: NF5815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5815-1 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 34909631 - 34909832
Alignment:
| Q |
1 |
gcaacggtgaagagtatgttgaatgtggattttgaacttgatgtgnnnnnnnnnnnngcaggttttgaaggcgtgtcatttccctgtaaccgtgactgta |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34909631 |
gcaacggtgaagagtatgttgaatttggattttgaacttgatgtgttttttctttttgcaggttttgaaggcgtgtcatttccctgtaaccgtgactgta |
34909730 |
T |
|
| Q |
101 |
gttcaattttctgttggaactgttcttgtaacctttatgtgggccctaaatctctacaaaagacctaaaatcactggtgccatggtattttgctctctgc |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34909731 |
gttcaatttgctgttggaactgttcttgtaacctttatgtgggctctaaatctctacaaaagacctaaaatcactggtgccatggtattttgctctctgc |
34909830 |
T |
|
| Q |
201 |
tc |
202 |
Q |
| |
|
|| |
|
|
| T |
34909831 |
tc |
34909832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 143
Target Start/End: Complemental strand, 289379 - 289296
Alignment:
| Q |
60 |
aggttttgaaggcgtgtcatttccctgtaaccgtgactgtagttcaattttctgttggaactgttcttgtaacctttatgtggg |
143 |
Q |
| |
|
|||||||||||| |||| ||||| ||| || |||| ||||||| ||||| || |||||||| |||||||||||||| |||||| |
|
|
| T |
289379 |
aggttttgaaggtttgtcttttccttgtgactgtgattgtagttgaatttgctattggaactattcttgtaacctttgtgtggg |
289296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 143
Target Start/End: Original strand, 18198418 - 18198501
Alignment:
| Q |
60 |
aggttttgaaggcgtgtcatttccctgtaaccgtgactgtagttcaattttctgttggaactgttcttgtaacctttatgtggg |
143 |
Q |
| |
|
|||||||||||| |||| ||||| ||| || |||| ||||||| ||||| || |||||||| |||||||||||||| |||||| |
|
|
| T |
18198418 |
aggttttgaaggtttgtcttttccttgtgactgtgattgtagttgaatttgctattggaactattcttgtaacctttgtgtggg |
18198501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University