View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5815-20 (Length: 55)
Name: Solexa-NF5815-20
Description: NF5815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5815-20 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 55; Significance: 2e-23; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 145735 - 145789
Alignment:
| Q |
1 |
aagaaaggaagttgttcgtgatgcttgaaagttggttggtgaaattctctcagct |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
145735 |
aagaaaggaagttgttcgtgatgcttgaaagttggttggtgaaattctctcagct |
145789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 153756 - 153810
Alignment:
| Q |
1 |
aagaaaggaagttgttcgtgatgcttgaaagttggttggtgaaattctctcagct |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153756 |
aagaaaggaagttgttcgtgatgcttgaaagttggttggtgaaattctctcagct |
153810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University