View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5815-9 (Length: 129)
Name: Solexa-NF5815-9
Description: NF5815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5815-9 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 2e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 2e-48
Query Start/End: Original strand, 9 - 129
Target Start/End: Complemental strand, 38243230 - 38243110
Alignment:
| Q |
9 |
ggrccttctgacctttggtccaacagtctgtgctgattgcgtgaatgcagagtctctcggctgctaggaatccaaattagtannttatttgtctccatct |
108 |
Q |
| |
|
|| |||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
38243230 |
ggaccttctgatctttggtccaacagtctgtgctgattgcgtgaatgtagagtctctcggctgctaggaatccaaattagtaatttatttgtctcaatct |
38243131 |
T |
|
| Q |
109 |
tgatttaactcttaaatgtaa |
129 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38243130 |
cgatttaactcttaaatgtaa |
38243110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 28 - 129
Target Start/End: Complemental strand, 38220359 - 38220258
Alignment:
| Q |
28 |
ccaacagtctgtgctgattgcgtgaatgcagagtctctcggctgctaggaatccaaattagtannttatttgtctccatcttgatttaactcttaaatgt |
127 |
Q |
| |
|
|||||||||| || ||||||||||||| |||||||| | ||| ||||||||||||| ||| || |||||||| |||| ||||||||||| |||||| |
|
|
| T |
38220359 |
ccaacagtctatgtcgattgcgtgaatgtagagtctcgagattgcaaggaatccaaatttgtagtttgtttgtctcaatctcgatttaactctgaaatgt |
38220260 |
T |
|
| Q |
128 |
aa |
129 |
Q |
| |
|
|| |
|
|
| T |
38220259 |
aa |
38220258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University