View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5817-11 (Length: 192)
Name: Solexa-NF5817-11
Description: NF5817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5817-11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 8 - 192
Target Start/End: Complemental strand, 39667425 - 39667241
Alignment:
| Q |
8 |
caggtgatgctgttgctgcatatgcattacctcaatggttgagattcattttcctctcaccatgtcctcaaagagctcttctttcagccgttgatgtctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39667425 |
caggtgatgctgttgctgcatatgcattacctcaatggttgagattcattttcctctcaccatgtcctcaaagagctcttctttcagccgttgatgtctt |
39667326 |
T |
|
| Q |
108 |
actcttgtttactctattagtctttgccatcacaaagctttattctaggttcactagttccaatagaaccaactcagaagaaatc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39667325 |
actcttgtttactctattagtctttgccatcacaaagctttattctaggttcactagttccaatagaacccactcagaagaaatc |
39667241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 70 - 192
Target Start/End: Complemental strand, 42257990 - 42257867
Alignment:
| Q |
70 |
tgtcctcaaagagctcttctttcagccgttgatgtcttactcttgtttactctattagtctttgccatcacaaagctttattc-taggttcactagttcc |
168 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42257990 |
tgtcttcaaagagctcttctttcagccgttgatgtcttactattgtttactctgttagtctttgccatcacaaagctttattcttaggttcactagttcc |
42257891 |
T |
|
| Q |
169 |
aatagaaccaactcagaagaaatc |
192 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
42257890 |
aatagaaccaactcggaagaaatc |
42257867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University