View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5817-17 (Length: 154)
Name: Solexa-NF5817-17
Description: NF5817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5817-17 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 5e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 5e-82
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 40444653 - 40444500
Alignment:
| Q |
1 |
gtaggatggaaattaattaatgttttgatgaattgcagatatccactttggttttgatacttattgttgacatgggaggttttggcttgacaatgataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40444653 |
gtaggatggaaattaattaatgttttgatgaattgcagatatccactttggttttgatacttattgttgacatgggaggttttggcttgacaatgataat |
40444554 |
T |
|
| Q |
101 |
caccaccttcattgtgaaaggttctttccatgttcaagttgtggggatgatttg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40444553 |
caccaccttcattgtgaaaggttctttccatgttcaagttgtggggatgatttg |
40444500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 6e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 6e-29
Query Start/End: Original strand, 8 - 104
Target Start/End: Original strand, 1516218 - 1516314
Alignment:
| Q |
8 |
ggaaattaattaatgttttgatgaattgcagatatccactttggttttgatacttattgttgacatgggaggttttggcttgacaatgataatcacc |
104 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||| |||| | ||||| ||||||||||| |||||||||||| |
|
|
| T |
1516218 |
ggaaattaataaatgttttgatgaattgcagatatccactttggtttttatacttgttgctgacctaggaggatttggcttgaccatgataatcacc |
1516314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University