View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5817-18 (Length: 153)
Name: Solexa-NF5817-18
Description: NF5817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5817-18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 7 - 149
Target Start/End: Complemental strand, 26099073 - 26098931
Alignment:
| Q |
7 |
acgatccaatgccatctcagaaactctccgtcactgacattcaaggccgaatctggcagtacacacatatctaccgcggtaaatccaagagacacctttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26099073 |
acgatccaatgccatctcagaaactctccgtcactgacattcaaggccgaatctggcagtacacacatatctaccgcggtaaatccaagagacacctttt |
26098974 |
T |
|
| Q |
107 |
tagtaggggatggacttcatttgtcaacaacaagaaactcgtc |
149 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26098973 |
cagtaggggatggacttcctttgtcaacaacaagaaactcgtc |
26098931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University