View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5817-21 (Length: 141)
Name: Solexa-NF5817-21
Description: NF5817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5817-21 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 8e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 8e-50
Query Start/End: Original strand, 9 - 141
Target Start/End: Original strand, 45844636 - 45844764
Alignment:
| Q |
9 |
aaaatttatattcttgaattgagtcaatctagatcaaatttgattcgactcatttttaacccgacaagagctgtcctcatttttaggataaaattaccag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
45844636 |
aaaatttatattcttgaattgagtcaatctagatcaaatttgattcgactcattttcaacccgacaagagttgtcctgatttttaggataaaatta---- |
45844731 |
T |
|
| Q |
109 |
ccaaatttcaaaatggcatgccgtcacttagtt |
141 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
45844732 |
ccaaatttcaaaatggcatgccgtcaattagtt |
45844764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University