View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5817-5 (Length: 224)
Name: Solexa-NF5817-5
Description: NF5817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5817-5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 9 - 121
Target Start/End: Complemental strand, 52741296 - 52741184
Alignment:
| Q |
9 |
tgtcatgcatgagtttatttagtgtgtgaaaatatatatttttcccatcttcttagtgcataaattacgagctaaaagtatatgtggactattttgagga |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52741296 |
tgtcatgcatcagtttatttagtgtgtgaaaatatatatttttcccatcttcttagtgcataaattacgagctaaaagtatatgtggactattttgagga |
52741197 |
T |
 |
| Q |
109 |
ctaaaagtattca |
121 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52741196 |
ctaaaagtattca |
52741184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 156 - 224
Target Start/End: Complemental strand, 52741158 - 52741090
Alignment:
| Q |
156 |
ggactactccaatattatggagaactgatattgctattaaaaatttactagattttttacccgtgttct |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52741158 |
ggactactccaatattatggagaactgatattgctattaaaaatttattagattttttacccgtgttct |
52741090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University