View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5817-8 (Length: 212)
Name: Solexa-NF5817-8
Description: NF5817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5817-8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 208
Target Start/End: Complemental strand, 47080674 - 47080474
Alignment:
| Q |
7 |
actgtaagtatacattaattgaaggttgagtctgtgacacaacaggggcactccggacacattctgtgctgctccctcaggtcctgccggtgaatcctaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47080674 |
actgtaagtatacattaattgaaggttgagtctgtgacacaacaggggcactccggacacattctgtg-tgctccctcaggtcctgccggtgaatcctaa |
47080576 |
T |
|
| Q |
107 |
caaacatagttttccaaatgcctgctccactctctcatttattgtttctgatctttcaatcttttctgtttcattcaaattttactagtaattcatctca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47080575 |
caaacatagttttccaaatgcctgctccactctctcatttattgtttctgatctttcaatcttttctgtttcattcaaattttactagtaattcatttca |
47080476 |
T |
|
| Q |
207 |
ct |
208 |
Q |
| |
|
|| |
|
|
| T |
47080475 |
ct |
47080474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University