View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5818-11 (Length: 111)
Name: Solexa-NF5818-11
Description: NF5818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5818-11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 3110054 - 3109946
Alignment:
| Q |
1 |
ctccgttgatccgtggatattgtaagatcaatgatgggcttagagcgagatcgttacacgatgacatgatttcgaagggtatagaaacacattgtgtgat |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | | |||||||||| |
|
|
| T |
3110054 |
ctccgttgacccgtggatattgtaagatcaatgatgggcttagagcgagatcattacacgatgacatgatttcgaagggtatag--agaaattgtgtgat |
3109957 |
T |
|
| Q |
101 |
tgttagctata |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
3109956 |
tgttagctata |
3109946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 106
Target Start/End: Original strand, 41626866 - 41626914
Alignment:
| Q |
58 |
acgatgacatgatttcgaagggtatagaaacacattgtgtgattgttag |
106 |
Q |
| |
|
|||| |||||||||| |||||||||| | ||| |||||||||||||||| |
|
|
| T |
41626866 |
acgaggacatgattttgaagggtataaagacaaattgtgtgattgttag |
41626914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University