View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5818-12 (Length: 110)
Name: Solexa-NF5818-12
Description: NF5818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5818-12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 1e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 8 - 110
Target Start/End: Complemental strand, 5071029 - 5070927
Alignment:
| Q |
8 |
aaatttttaattaagttgtttattcaagcaaaacttaatttttcagctgttgagattacttaatttttaaactatctatcactcaaacctattcttccat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5071029 |
aaatttttaattaagttgtttattcaagcaaaacttaatttttcagctgttgaggttacttaatgtttaaactatctatcactcaaacctattctttcat |
5070930 |
T |
 |
| Q |
108 |
cca |
110 |
Q |
| |
|
||| |
|
|
| T |
5070929 |
cca |
5070927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University