View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5818-16 (Length: 57)
Name: Solexa-NF5818-16
Description: NF5818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5818-16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 8 - 57
Target Start/End: Original strand, 2777852 - 2777901
Alignment:
| Q |
8 |
gaattatatattgggcttaagcaatgatgagaacaattgggcaggtttgt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2777852 |
gaattatatattgggcttaagcaatgatgagaacaattgggcaggtttgt |
2777901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 2e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 55320557 - 55320508
Alignment:
| Q |
8 |
gaattatatattgggcttaagcaatgatgagaacaattgggcaggtttgt |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55320557 |
gaattatatattgggcttaagcaatgatgagaacaattgggcaggtttgt |
55320508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-18
Query Start/End: Original strand, 7 - 56
Target Start/End: Complemental strand, 31951658 - 31951609
Alignment:
| Q |
7 |
agaattatatattgggcttaagcaatgatgagaacaattgggcaggtttg |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31951658 |
agaattatatattgggcttaagcaatgatgtgaacaattgggcaggtttg |
31951609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University