View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5818-9 (Length: 136)

Name: Solexa-NF5818-9
Description: NF5818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5818-9
Solexa-NF5818-9
[»] chr1 (1 HSPs)
chr1 (1-118)||(5070466-5070583)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 8e-56; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 8e-56
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 5070466 - 5070583
Alignment:
1 gaaagacaataatttagttttgttattctttcaataaacaatgttttttatgttacttttatcagtataagttttttgtgggtgtcgtttagatatcaaa 100  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
5070466 gaaagacaataatttagttttgttattatttcaataaacaatgttttttatgttacttatatcagtataagttttttgtgggtgtcgtttagatatcaaa 5070565  T
101 tgtagagtgtgccatgag 118  Q
    ||||||||||||||||||    
5070566 tgtagagtgtgccatgag 5070583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University