View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5819-12 (Length: 47)
Name: Solexa-NF5819-12
Description: NF5819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5819-12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 41; Significance: 0.000000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.000000000000003
Query Start/End: Original strand, 7 - 47
Target Start/End: Complemental strand, 42122421 - 42122381
Alignment:
| Q |
7 |
tgcactcggttgcatactacagtcttaactaattgaatgat |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42122421 |
tgcactcggttgcatactacagtcttaactaattgaatgat |
42122381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University