View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5819-3 (Length: 114)
Name: Solexa-NF5819-3
Description: NF5819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5819-3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 5762834 - 5762946
Alignment:
| Q |
1 |
tttattcttttaagtttcattagattggtagaatatatgttcttcataattaaaattaccagatgatatgtggaaacttaccttgcttggtactgttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5762834 |
tttattcttttaagtttcattagattggtagaatatatgttcttcataattaaaattaccagatgatatgtggaaacttatcttgcttggtactgttttt |
5762933 |
T |
 |
| Q |
101 |
gttaggctctctg |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5762934 |
gttaggctctctg |
5762946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University