View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5819-5 (Length: 110)
Name: Solexa-NF5819-5
Description: NF5819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5819-5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 4e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 19272686 - 19272745
Alignment:
| Q |
8 |
agtagcacttttgtaactaatattttttggtccataatctgacaagagaagatattatta |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19272686 |
agtagcacttttgtaactaatattttttggtccataatctgacaagagaagatattatta |
19272745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 65 - 110
Target Start/End: Original strand, 19273584 - 19273629
Alignment:
| Q |
65 |
ttaagtagcaaattatttcatgattgctctatgcatgtaccatatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19273584 |
ttaagtagcaaattatttcatgattgctctatgcatgtaccatatt |
19273629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University