View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5819-7 (Length: 91)
Name: Solexa-NF5819-7
Description: NF5819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5819-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 1e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 2 - 87
Target Start/End: Complemental strand, 5552225 - 5552140
Alignment:
| Q |
2 |
tagctttgtctttaaattcaatacttcgtctagaattctcccttatatccatgctgggtctaggtttctctctaaaatctgtgctg |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5552225 |
tagctttgtctttaaattcaatacttcgtctagaattctcccttatatccatgctgggtctaggtttctctctaaaatctgtgctg |
5552140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University