View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5820-11 (Length: 82)
Name: Solexa-NF5820-11
Description: NF5820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5820-11 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 7e-21; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 7e-21
Query Start/End: Original strand, 28 - 82
Target Start/End: Original strand, 27596351 - 27596405
Alignment:
| Q |
28 |
gcttcaacaacttttctgttctagtttttatttgctttgaaattgtagaatataa |
82 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27596351 |
gcttcaacaacttttctgttctattttttatttgctttgaaattgtagaatataa |
27596405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 28 - 82
Target Start/End: Original strand, 27616313 - 27616367
Alignment:
| Q |
28 |
gcttcaacaacttttctgttctagtttttatttgctttgaaattgtagaatataa |
82 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||| |||| |||||||||||| |
|
|
| T |
27616313 |
gcttcaacaatttttctgttctattttttatttgcttcgaaaatgtagaatataa |
27616367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 82
Target Start/End: Original strand, 27694441 - 27694494
Alignment:
| Q |
29 |
cttcaacaacttttctgttctagtttttatttgctttgaaattgtagaatataa |
82 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
27694441 |
cttcaacaatttttctgttctattttttatttgcttcgaaaacgtagaatataa |
27694494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 82
Target Start/End: Original strand, 29263870 - 29263923
Alignment:
| Q |
29 |
cttcaacaacttttctgttctagtttttatttgctttgaaattgtagaatataa |
82 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
29263870 |
cttcaacaatttttctattctattttttatttgcttcgaaaacgtagaatataa |
29263923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University