View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5820-3 (Length: 151)
Name: Solexa-NF5820-3
Description: NF5820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5820-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 11 - 147
Target Start/End: Complemental strand, 21491107 - 21490971
Alignment:
| Q |
11 |
caaaggaacgcatgaggacaaatatatggttttgttcgtttctccaatgttaagaatgcaagtaagttatctcaagctttaagcaatgtttggttcggtc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21491107 |
caaaggaacgcatgaggacaaatatatggtttcgttcgtttctccaatgttaagaatgcaagtaagttatctcaagctttaaacaatgtttggttcggtc |
21491008 |
T |
|
| Q |
111 |
atcttaaggtttgagctagagaaacacggtacgatag |
147 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21491007 |
atcttaaggtttggactagagaaacacggtacgatag |
21490971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University