View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5820-6 (Length: 127)
Name: Solexa-NF5820-6
Description: NF5820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5820-6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 4e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 8 - 123
Target Start/End: Complemental strand, 46186226 - 46186111
Alignment:
| Q |
8 |
gaaagaatatgaatccaagcaaattttaactactcgatcaaaacttgaggagcatgcttcatttgtttataaaagaaacattttctgcaaatttcaagaa |
107 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46186226 |
gaaagaatatgaatccaagcgcattttaactactggatcaaaacttgaagagcatgcttcatttgtttataaaagaaaaattttctgcaaatttcaagaa |
46186127 |
T |
 |
| Q |
108 |
gagcttgcacagatca |
123 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
46186126 |
gagcttgcacggatca |
46186111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University