View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5821-13 (Length: 139)
Name: Solexa-NF5821-13
Description: NF5821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5821-13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 3e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 2 - 139
Target Start/End: Complemental strand, 26113630 - 26113493
Alignment:
| Q |
2 |
gcaccacagatgattaaattgaccaatgtcttcacgaaatggttatattgatatattttatgcaatttcctaatagttgatgtgcaaatagcgagggcaa |
101 |
Q |
| |
|
||||| || ||||||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26113630 |
gcaccgcacatgattaaattgatcaatgtcttcacgaaatggttatattgacatattttatgcagtttcctaatagttgatgtgcaaatagcgagggcaa |
26113531 |
T |
|
| Q |
102 |
caactttattgactccaagaccttaaaccttattaact |
139 |
Q |
| |
|
||||||| ||||||||| | |||||| ||||||||| |
|
|
| T |
26113530 |
caactttcgtgactccaaatctttaaacattattaact |
26113493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 90; Significance: 7e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 7e-44
Query Start/End: Original strand, 2 - 119
Target Start/End: Original strand, 12092081 - 12092198
Alignment:
| Q |
2 |
gcaccacagatgattaaattgaccaatgtcttcacgaaatggttatattgatatattttatgcaatttcctaatagttgatgtgcaaatagcgagggcaa |
101 |
Q |
| |
|
||||| || ||||||||||||| |||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12092081 |
gcaccgcacatgattaaattgatcaatgtcttcacgaaatggttatattaacatattttatgcaatttcctaatagttgatgtgcaaatatcgagggcaa |
12092180 |
T |
|
| Q |
102 |
caactttattgactccaa |
119 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
12092181 |
caactttagtgactccaa |
12092198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University