View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5821-15 (Length: 132)
Name: Solexa-NF5821-15
Description: NF5821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5821-15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 3e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 3 - 124
Target Start/End: Complemental strand, 3879475 - 3879354
Alignment:
| Q |
3 |
atgaagcagaaacatacttgcgacagtacgccaatctaatattcttcaaacgtggaagatccaacgacgcttaagtcaatagactgcaactgcggagtta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3879475 |
atgaagcagaaacatacttgcgacagtacgccaatctaatattcttcaaatgtggaagatccaacgacgctcaagtcaatagactgcaactgcggagtta |
3879376 |
T |
|
| Q |
103 |
caaaacctgcattggcggggtg |
124 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3879375 |
caaaacctgcattggcggggtg |
3879354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 4e-33
Query Start/End: Original strand, 3 - 118
Target Start/End: Complemental strand, 3865493 - 3865378
Alignment:
| Q |
3 |
atgaagcagaaacatacttgcgacagtacgccaatctaatattcttcaaacgtggaagatccaacgacgcttaagtcaatagactgcaactgcggagtta |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||| || || | |
|
|
| T |
3865493 |
atgaagcagaaacatacttgcgacagtacaccaatctaatattctgcaaacgtggaagatccaacgacaccgaagtcaatagactgcaattgtcaagctc |
3865394 |
T |
|
| Q |
103 |
caaaacctgcattggc |
118 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3865393 |
caaaacctgcattggc |
3865378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University