View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5821-19 (Length: 127)
Name: Solexa-NF5821-19
Description: NF5821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5821-19 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 10 - 127
Target Start/End: Original strand, 1270900 - 1271017
Alignment:
| Q |
10 |
tatagcagagcagaattttaacaaaccgctattgttctactatacgataattagtattaaataatagttatagctgcattgttgcgtaacgaaatttaaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1270900 |
tatagcagagcagaattttaacaaaccgctattgttctattatacgataattagtattaaataatagttatagctgcattgttgcgtaacgaaatttaaa |
1270999 |
T |
 |
| Q |
110 |
taaaccactatttactgg |
127 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1271000 |
taaaccactatttactgg |
1271017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 28; Significance: 0.0000006; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 10 - 45
Target Start/End: Original strand, 12196911 - 12196946
Alignment:
| Q |
10 |
tatagcagagcagaattttaacaaaccgctattgtt |
45 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
12196911 |
tatagcacagcaaaattttaacaaaccgctattgtt |
12196946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 10 - 45
Target Start/End: Original strand, 12441339 - 12441374
Alignment:
| Q |
10 |
tatagcagagcagaattttaacaaaccgctattgtt |
45 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
12441339 |
tatagcacagcaaaattttaacaaaccgctattgtt |
12441374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 28; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 11 - 46
Target Start/End: Complemental strand, 25183378 - 25183343
Alignment:
| Q |
11 |
atagcagagcagaattttaacaaaccgctattgttc |
46 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||| |
|
|
| T |
25183378 |
atagcatagcagaatttcaacaaaccgctattgttc |
25183343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University