View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5821-21 (Length: 123)
Name: Solexa-NF5821-21
Description: NF5821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5821-21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 2e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 7 - 108
Target Start/End: Original strand, 3878501 - 3878602
Alignment:
| Q |
7 |
acattgcactgaatcaagtcatgttggattctggctgatttgtttcattattttcaggaagctggaggttttaacattaggaagaggacaaatagtggat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3878501 |
acattgcactgaatcaagtcatgttggattctggctgatttgtttcattattttcaggaagctcgaggttttaacattaggaagaggacaaataggggat |
3878600 |
T |
|
| Q |
107 |
gc |
108 |
Q |
| |
|
|| |
|
|
| T |
3878601 |
gc |
3878602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 44 - 108
Target Start/End: Original strand, 3864531 - 3864595
Alignment:
| Q |
44 |
atttgtttcattattttcaggaagctggaggttttaacattaggaagaggacaaatagtggatgc |
108 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||||||||| ||||||||||| |||| |||||| |
|
|
| T |
3864531 |
atttgtttcattcttttcaggaatcttgaggttttaacattgggaagaggacagataggggatgc |
3864595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University