View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5821-27 (Length: 70)
Name: Solexa-NF5821-27
Description: NF5821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5821-27 |
 |  |
|
| [»] chr5 (13 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 1e-28; HSPs: 13)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 7 - 70
Target Start/End: Complemental strand, 37704177 - 37704114
Alignment:
| Q |
7 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37704177 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacaccgtgt |
37704114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 9e-23
Query Start/End: Original strand, 7 - 64
Target Start/End: Complemental strand, 37430266 - 37430209
Alignment:
| Q |
7 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgaca |
64 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37430266 |
acagaatcttggaaaaccggcacagattgctgcgagtgggatggtgtcacgtgcgaca |
37430209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 37391606 - 37391665
Alignment:
| Q |
7 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacacc |
66 |
Q |
| |
|
|||||||||||||||| | | ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
37391606 |
acagaatcttggaaaaacagtacaaattgttgcaagtgggatggtgtcacgtgcgacacc |
37391665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Original strand, 37399472 - 37399531
Alignment:
| Q |
7 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacacc |
66 |
Q |
| |
|
|||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37399472 |
acagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacacc |
37399531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 37437210 - 37437151
Alignment:
| Q |
7 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacacc |
66 |
Q |
| |
|
|||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37437210 |
acagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacacc |
37437151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 37534615 - 37534556
Alignment:
| Q |
7 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacacc |
66 |
Q |
| |
|
|||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37534615 |
acagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacacc |
37534556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 37595839 - 37595780
Alignment:
| Q |
7 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacacc |
66 |
Q |
| |
|
|||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37595839 |
acagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacacc |
37595780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 37641387 - 37641328
Alignment:
| Q |
7 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacacc |
66 |
Q |
| |
|
|||||||||||||||| | ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37641387 |
acagaatcttggaaaaacaatacagattgttgtgagtgggatggtgtcacgtgcgacacc |
37641328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 37713133 - 37713074
Alignment:
| Q |
7 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacacc |
66 |
Q |
| |
|
|||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37713133 |
acagaatcttggcaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacacc |
37713074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 37825404 - 37825345
Alignment:
| Q |
7 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacacc |
66 |
Q |
| |
|
|||||||||||| ||| | | ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37825404 |
acagaatcttgggaaaacagtacagattgttgtgagtgggatggtgtcacgtgcgacacc |
37825345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 65
Target Start/End: Complemental strand, 37698302 - 37698244
Alignment:
| Q |
7 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacac |
65 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
37698302 |
acagaatcttggaaaaacaatacagattgttgcaagtgggatggtgtcacgtgtgacac |
37698244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 68
Target Start/End: Original strand, 37411981 - 37412021
Alignment:
| Q |
28 |
acagattgttgcgagtgggatggtgtcacgtgcgacaccgt |
68 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
37411981 |
acagattgttgcgagtggtatggtgtcatgtgcgacaccgt |
37412021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 63
Target Start/End: Original strand, 37381001 - 37381036
Alignment:
| Q |
28 |
acagattgttgcgagtgggatggtgtcacgtgcgac |
63 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||| |
|
|
| T |
37381001 |
acagattgttgtgggtgggatggtgtcacgtgcgac |
37381036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 9e-17
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 14554541 - 14554482
Alignment:
| Q |
7 |
acagaatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacacc |
66 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14554541 |
acagaatcttggaaaaagagtacagattgttgcgagtgggatggtgtcacgtgcgacacc |
14554482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 16841525 - 16841579
Alignment:
| Q |
11 |
aatcttggaaaaccggcacagattgttgcgagtgggatggtgtcacgtgcgacac |
65 |
Q |
| |
|
|||||||||||| ||| || ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
16841525 |
aatcttggaaaaacggtacggattgttgcaagtgggatggtgtcacgtgtgacac |
16841579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University