View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5821-3 (Length: 170)
Name: Solexa-NF5821-3
Description: NF5821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5821-3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 2e-78; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 8 - 159
Target Start/End: Complemental strand, 9818860 - 9818709
Alignment:
| Q |
8 |
tgtgattctgtccctagaaaatggatgtcttaaataagtaatactctttcttgattatttttcttttgagttccatttgagtttcttctaattgcaggtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9818860 |
tgtgattctgtccctagaaaatggatgtcttaaataagtaatactctttcttgattatttttcttttgagttccatttgagttttttctaattgcaggtt |
9818761 |
T |
|
| Q |
108 |
gtgaaggagccctttgatgcaacttttggtaatagggaatgctgttgttttt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9818760 |
gtgaaggagccctttgatgcaacttttggtaatagggaatgctgttgttttt |
9818709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 1e-36
Query Start/End: Original strand, 31 - 159
Target Start/End: Complemental strand, 9824520 - 9824388
Alignment:
| Q |
31 |
gatgtcttaaataagtaatactctttcttgattattttt-ctt-ttga--gttccatttgagtttcttctaattgcaggttgtgaaggagccctttgatg |
126 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||| ||||| ||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
9824520 |
gatgtattaaataagaaatactctttcttgatttttttttcttcttgaaagttccatttgagtttcttttaattgcaggttgtgaaggagccctttgaag |
9824421 |
T |
|
| Q |
127 |
caacttttggtaatagggaatgctgttgttttt |
159 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| |
|
|
| T |
9824420 |
caactttttgtaataggaaatgctgttgttttt |
9824388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 25 - 141
Target Start/End: Complemental strand, 4966939 - 4966829
Alignment:
| Q |
25 |
aaaatggatgtcttaaataagtaatactctttcttgattatttttcttttgagttccatttgagtttcttctaattgcaggttgtgaaggagccctttga |
124 |
Q |
| |
|
||||| |||||||| |||||| ||||||||| |||| |||||||| ||||| ||| |||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
4966939 |
aaaattgatgtcttgaataagaaatactctt----gattttttttctt--gagttacatatgagtttcttttaattgcaggttgtgaaggagccatttgt |
4966846 |
T |
|
| Q |
125 |
tgcaacttttggtaata |
141 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
4966845 |
tgcaacttttggcaata |
4966829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.0000000009; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.0000000009
Query Start/End: Original strand, 96 - 136
Target Start/End: Original strand, 9488740 - 9488780
Alignment:
| Q |
96 |
taattgcaggttgtgaaggagccctttgatgcaacttttgg |
136 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
9488740 |
taattgtaggttgtgaaggagccctttggtgcaacttttgg |
9488780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.0000000009
Query Start/End: Original strand, 81 - 141
Target Start/End: Complemental strand, 23202837 - 23202777
Alignment:
| Q |
81 |
catttgagtttcttctaattgcaggttgtgaaggagccctttgatgcaacttttggtaata |
141 |
Q |
| |
|
||||||| ||| || |||||| |||||||||| |||||||||| |||||||||||| |||| |
|
|
| T |
23202837 |
catttgaatttattttaattgtaggttgtgaacgagccctttggtgcaacttttggcaata |
23202777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University