View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5821-4 (Length: 165)
Name: Solexa-NF5821-4
Description: NF5821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5821-4 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 9e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 9e-84
Query Start/End: Original strand, 5 - 165
Target Start/End: Complemental strand, 1271321 - 1271161
Alignment:
| Q |
5 |
ttggactagaatgactaagttgggattgtagaggtgaaaatgcaggagcagcacgagaagctgatcgcattgattgaatttttcctttaccaacaacata |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1271321 |
ttggactagaatgactaagttgggattgtagaggtgaaaatgaaggagcagcacgagaagctgatcgcattgattgaatttttcctttaccaacaacata |
1271222 |
T |
|
| Q |
105 |
tactgtacaaaaatctggtgccccttttgatattgttgctggaatatctaccaccttgaac |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1271221 |
tactgtacaaaaatctggtgccccttttgatattgttgctggaatatctaccaccttgaac |
1271161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 1258040 - 1257989
Alignment:
| Q |
76 |
gattgaatttttcctttaccaacaacatatactgtacaaaaatctggtgccc |
127 |
Q |
| |
|
|||||||||||||||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
1258040 |
gattgaatttttcctttaaaaagaacatataccgtacaaaaatctggtgccc |
1257989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 4e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 4e-24
Query Start/End: Original strand, 49 - 153
Target Start/End: Original strand, 50441903 - 50442007
Alignment:
| Q |
49 |
ggagcagcacgagaagctgatcgcattgattgaatttttcctttaccaacaacatatactgtacaaaaatctggtgccccttttgatattgttgctggaa |
148 |
Q |
| |
|
||||||| ||||||||| |||||||| |||||||| |||||||| |||| ||||| ||||||||||||||||||||||||||||| | |||| | |||| |
|
|
| T |
50441903 |
ggagcaggacgagaagcagatcgcatcgattgaatctttcctttgccaatgacatagactgtacaaaaatctggtgccccttttgacactgttccaggaa |
50442002 |
T |
|
| Q |
149 |
tatct |
153 |
Q |
| |
|
||||| |
|
|
| T |
50442003 |
tatct |
50442007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 60 - 134
Target Start/End: Original strand, 50446905 - 50446979
Alignment:
| Q |
60 |
agaagctgatcgcattgattgaatttttcctttaccaacaacatatactgtacaaaaatctggtgccccttttga |
134 |
Q |
| |
|
|||||| | ||||||||||||||| ||||| || |||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
50446905 |
agaagcaggtcgcattgattgaatctttccattgccaatgacatagactgtacagaaatctggtgccccttttga |
50446979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University