View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5821-6 (Length: 149)
Name: Solexa-NF5821-6
Description: NF5821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5821-6 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] scaffold0144 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 3e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 2879736 - 2879884
Alignment:
| Q |
1 |
agagaggaagcagcgcatgacaatgggaaaggaaggcaacgacaattaaagggatccggatagagaacggcgatgcagggtgacgttggtcttgtcggaa |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2879736 |
agagaagaagcagcgcatgacaatgggaaaggaaggcaacgacaattaaagggatccggatagagaacgacgatgcagggtgacgttggtcttgtcggaa |
2879835 |
T |
|
| Q |
101 |
aatttgtccggtttattctcttttctttgttgtttattttctttatcat |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2879836 |
aatttgtccggtttattctcttttctttgttgtttattttctttatcat |
2879884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 88; Significance: 1e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 53436418 - 53436540
Alignment:
| Q |
1 |
agagaggaagcagcgcatgacaatgggaaaggaaggcaacgacaattaaagggatccggatagagaacggcgatgcagggtgacgttggtcttgtcggaa |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53436418 |
agagaagaagcagcgcatgacaatgggaaaggaaggcaacgacaattaaagggatccggatagagaacggcgatgcagggtgac-------------gaa |
53436504 |
T |
|
| Q |
101 |
aatttgtccggtttattctcttttctttgttgttta |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
53436505 |
aatttgtccggtttattctcttttctttgttgttta |
53436540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 2e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 93 - 149
Target Start/End: Original strand, 28633687 - 28633743
Alignment:
| Q |
93 |
tgtcggaaaatttgtccggtttattctcttttctttgttgtttattttctttatcat |
149 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28633687 |
tgtcagaaaatttgtctggtttattctcttttctttgttgtttattttctttatcat |
28633743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0144 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0144
Description:
Target: scaffold0144; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 93 - 145
Target Start/End: Complemental strand, 40392 - 40340
Alignment:
| Q |
93 |
tgtcggaaaatttgtccggtttattctcttttctttgttgtttattttcttta |
145 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40392 |
tgtcagaaaatttgtctggtttattctcttttctttgttgtttgttttcttta |
40340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University