View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5821-9 (Length: 143)
Name: Solexa-NF5821-9
Description: NF5821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5821-9 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 4e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 4 - 143
Target Start/End: Original strand, 38452824 - 38452964
Alignment:
| Q |
4 |
atgaagttgatatgagttaaaagtgaaaaaggaagcattccatatgcatatggattacgctcatcaatgatgagtggaaaaactgaacccctttggattt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38452824 |
atgaagttgatatgagttaaaagtgaaaaaagaagcattccatatgcatatggattacgctcatcaatgatgagtggaaaaactgaacccctttggattt |
38452923 |
T |
|
| Q |
104 |
tcttgtggaattcatgtacctc-taatctgtttacaatctc |
143 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38452924 |
tcttgtggaattcatgtacctcttaatctgtttacaatctc |
38452964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 66 - 136
Target Start/End: Complemental strand, 38637798 - 38637727
Alignment:
| Q |
66 |
atcaatgatgagtggaaaaactgaacccctttggattttcttgtggaattcatgtacctc-taatctgttta |
136 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||||||||| | || ||||||||||||||| ||||||||||| |
|
|
| T |
38637798 |
atcaatgatgagtggaaaaactaagcccttttggattttatcgtagaattcatgtacctcttaatctgttta |
38637727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University