View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5822-11 (Length: 137)
Name: Solexa-NF5822-11
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5822-11 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 6e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 6e-72
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 17146432 - 17146296
Alignment:
| Q |
1 |
gaaagacgaagaagaagaggtaaaaggttatggagattggaacaagaaattgcttgaagaagcagtttttgcaatgtatgagaatactgagaggacttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17146432 |
gaaagacgaagaagaagaggtaaaaggttatggagattggaacaagaaattgcttgaagaagcagtttttgcaatgtatgagaatactgagaggacttat |
17146333 |
T |
|
| Q |
101 |
acttcagctggtgatttggagtgtttagattatgaag |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17146332 |
acttcagctggtgatttggagtgtttagattatgaag |
17146296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University