View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5822-12 (Length: 136)
Name: Solexa-NF5822-12
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5822-12 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 13 - 136
Target Start/End: Original strand, 4223762 - 4223885
Alignment:
| Q |
13 |
ggaaaaggtcgtttaggaacagtttatgctggtaaactcgaaaatgaagagcttgtagctgtgaaacgcattcattctgttcttgtgttaagcaacgcat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4223762 |
ggaaaaggtcgtttaggaacagtttatgctggtaaactcgaaaatgaagagcttgtagctgtgaaacgcattcattctgttcttgtgttaagcaacgcag |
4223861 |
T |
|
| Q |
113 |
gatttggtttctcatctgtcatga |
136 |
Q |
| |
|
| |||||||| |||||||| |||| |
|
|
| T |
4223862 |
gttttggtttttcatctgtgatga |
4223885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University