View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5822-18 (Length: 128)
Name: Solexa-NF5822-18
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5822-18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 8 - 110
Target Start/End: Complemental strand, 55289459 - 55289357
Alignment:
| Q |
8 |
tttccatggactcctttattcatgcaatatcatggatgcaatgcaatcctgcaatattcatggactactttaccaatgcaaacttactaggtacaatatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55289459 |
tttccatggactcctttattcatgcaatatcatggatgcaatgcaatcctgcaatattcatggactactttaccattgcaaacttactaggtacaatatt |
55289360 |
T |
|
| Q |
108 |
taa |
110 |
Q |
| |
|
||| |
|
|
| T |
55289359 |
taa |
55289357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University