View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5822-21 (Length: 126)
Name: Solexa-NF5822-21
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5822-21 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 3e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 8 - 126
Target Start/End: Original strand, 36551668 - 36551786
Alignment:
| Q |
8 |
acataaacacaccattatatagcaatgttaatgtgtgatgtttggtgatgatacgtaccaagtaatgtaagatttaaagagtgtaatacggagaagaaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36551668 |
acataaacacaccattatatagcaatgttaatgtgtgatgtttggtgatgatacgtaccaagtaatgtaagatttaaagagtgtaatacggagaagaaaa |
36551767 |
T |
 |
| Q |
108 |
tttattgcctttaatggca |
126 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36551768 |
tttattgcctttaatggca |
36551786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 32 - 124
Target Start/End: Original strand, 36549002 - 36549092
Alignment:
| Q |
32 |
atgttaatgtgtgatgtttggtgatgatacgtaccaagtaatgtaagatttaaagagtgtaatacggagaagaaaatttattgcctttaatgg |
124 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||| | || ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36549002 |
atgttaatgtgtgaatgttggcgatgatacgtaccaagtaatagagga-ttaaagagtgtaatacggagaag-aaatttattgcctttaatgg |
36549092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University