View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5822-22 (Length: 126)

Name: Solexa-NF5822-22
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5822-22
Solexa-NF5822-22
[»] chr1 (1 HSPs)
chr1 (7-126)||(50423391-50423510)


Alignment Details
Target: chr1 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 7 - 126
Target Start/End: Complemental strand, 50423510 - 50423391
Alignment:
7 acctgtaactaaaataaaattatgctttcttcctttacaacttacattttgcagtaatctagcactggaatgaaatttcagcaaaaacaccaatacggaa 106  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||    
50423510 acctgtagctaaaataaaattatgctttcttcctttacaacttacattttgcagtaatctagcactggaatgaaatttcagcaaaaacaccaatgtggaa 50423411  T
107 agaagagttgtagcacaaca 126  Q
    ||||||||||||||||||||    
50423410 agaagagttgtagcacaaca 50423391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University