View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5822-23 (Length: 125)
Name: Solexa-NF5822-23
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5822-23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 33507353 - 33507236
Alignment:
| Q |
8 |
aaacctaaatattaaatctatggtgccttgagtaatgtttttattttgtatatggaaaataatatgtgtcgttgactattgcaaaactttcttcaatccc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33507353 |
aaacctaaatattaaatctatggtgccttgagtaatgtttttattttgtatacggaaaataatatgtgtcgttgactattgcaaaactttcttcaatccc |
33507254 |
T |
 |
| Q |
108 |
tggtttcaattatattaa |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33507253 |
tggtttcaattatattaa |
33507236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University