View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5822-24 (Length: 125)
Name: Solexa-NF5822-24
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5822-24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 2e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 47198835 - 47198946
Alignment:
| Q |
1 |
attgaatttaaagttacattgaaataagtgagttagaag---tattactttgcaatcttt-aaattagaaaaggatctttagtggattataatagatcct |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47198835 |
attgaatttaaagttacattgaaataagtgagttagaagaagtattactt-gcaatcttttaaattagaaaaggatctttagtagattataatagatcct |
47198933 |
T |
 |
| Q |
97 |
tgccatttagctt |
109 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47198934 |
tgccatttagctt |
47198946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University