View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5822-25 (Length: 117)
Name: Solexa-NF5822-25
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5822-25 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 6e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 6e-47
Query Start/End: Original strand, 8 - 117
Target Start/End: Complemental strand, 47199593 - 47199483
Alignment:
| Q |
8 |
cgaagagactccaaatgtctaagttattccactttattcatcaattttcctttgtacttttcaaaact-aactaggttgaaatttcttttactttcattg |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47199593 |
cgaagagactccaaatgtctaatttattccactttattcatcaattttcctatgtacttttcaaaactaaactaggttgaaatttcttttactttcattg |
47199494 |
T |
|
| Q |
107 |
catcttcataa |
117 |
Q |
| |
|
||||||||||| |
|
|
| T |
47199493 |
catcttcataa |
47199483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University