View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5822-26 (Length: 116)
Name: Solexa-NF5822-26
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5822-26 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 6e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 6e-50
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 10855497 - 10855382
Alignment:
| Q |
1 |
tcttcttgacattcgagtatcactaagttacactgatatgcatacaattcttttagcatgggccattctagcttatgtaaaccacgataacactatttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
10855497 |
tcttcttgacattcgagtatcactaagttacaccgatatgcatgcaattcttttagcatgggccattctagcttatgtaaaccacgataaaagtatttga |
10855398 |
T |
 |
| Q |
101 |
gcgctggcaattttat |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10855397 |
gcgctggcaattttat |
10855382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University