View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5822-27 (Length: 110)
Name: Solexa-NF5822-27
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5822-27 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 2e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 8 - 110
Target Start/End: Original strand, 47582249 - 47582351
Alignment:
| Q |
8 |
gtgcctcccgtgcctatctgcagagaactgcagctggtgtcttagtgatgccatagctgaagttccaaccagttgctgcagaggaaaatctggaggcaca |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47582249 |
gtgcctcccatgcctatctgcagagaactgcagctggtgtcttagtgatgccatagctgaagttccaaccagttgctgcagaggaaaatctggaggcaca |
47582348 |
T |
 |
| Q |
108 |
ata |
110 |
Q |
| |
|
||| |
|
|
| T |
47582349 |
ata |
47582351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 47572563 - 47572646
Alignment:
| Q |
20 |
cctatctgcagagaactgcagctggtgtcttagtgatgccatagctgaagttccaaccagttgctgcagaggaaaatctggagg |
103 |
Q |
| |
|
||||||| |||| ||||| |||||||||||||| ||||||||||| ||| ||||||| ||||| |||||||||||||||||||| |
|
|
| T |
47572563 |
cctatcttcagaaaactgtagctggtgtcttagcgatgccatagcagaaattccaactagttgttgcagaggaaaatctggagg |
47572646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University